Statistical mechanics: Difference between revisions
en>Skizzik m Reverted edits by 196.11.235.234 (talk) to last version by Gerrit C. Groenenboom |
|||
| Line 1: | Line 1: | ||
In [[genetics]], '''shotgun sequencing''', also known as '''shotgun cloning''', is a method used for [[sequencing]] long [[DNA]] strands. It is named by analogy with the rapidly expanding, quasi-random firing pattern of a [[shotgun]]. | |||
Since the [[chain termination method]] of [[DNA sequencing]] can only be used for fairly short strands (100 to 1000 basepairs), longer sequences must be subdivided into smaller fragments, and subsequently re-assembled to give the overall sequence. Two principal methods are used for this: [[chromosome walking]], which progresses through the entire strand, piece by piece, and shotgun sequencing, which is a faster but more complex process, and uses random fragments. | |||
In shotgun sequencing,<ref name="Staden">{{cite journal | |||
| last = Staden | |||
| first = R | |||
| coauthors = | |||
| title = A strategy of DNA sequencing employing computer programs | |||
| journal = Nucleic Acids Research | |||
| volume = 6 | |||
| issue = 7 | |||
| pages = 2601–10 | |||
| year = 1979 | |||
| pmid = 461197 | |||
| doi = 10.1093/nar/6.7.2601 | |||
| pmc = 327874}}</ref><ref>{{cite journal | |||
| last = Anderson | |||
| first = S | |||
| coauthors = | |||
| title = Shotgun DNA sequencing using cloned DNase I-generated fragments | |||
| journal = Nucleic Acids Research | |||
| volume = 9 | |||
| issue = 13 | |||
| pages = 3015–27 | |||
| year = 1981 | |||
| pmid = 6269069 | |||
| doi = 10.1093/nar/9.13.3015 | |||
| pmc = 327328}}</ref> | |||
DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain ''reads''. Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Computer programs then use the overlapping ends of different reads to assemble them into a continuous sequence.<ref name="Staden" /> | |||
Shotgun sequencing was one of the precursor technologies that was responsible for enabling [[full genome sequencing]]. | |||
==Example== | |||
For example, consider the following two rounds of shotgun reads: | |||
{| class="wikitable" | |||
|- | |||
! Strand | |||
! Sequence | |||
|- | |||
| Original | |||
| <code><big>AGCATGCTGCAGTCATGCTTAGGCTA</big></code> | |||
|- | |||
| First shotgun sequence | |||
| <code><big>AGCATGCTGCAGTCATGCT-------<br/>-------------------TAGGCTA</big></code> | |||
|- | |||
| Second shotgun sequence | |||
| <code><big>AGCATG--------------------<br/>------CTGCAGTCATGCTTAGGCTA</big></code> | |||
|- | |||
| Reconstruction | |||
| <code><big>AGCATGCTGCAGTCATGCTTAGGCTA</big></code> | |||
|} | |||
In this extremely simplified example, none of the reads cover the full length of the original sequence, but the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally complicated by the great abundance of [[Repeated sequence (DNA)|repetitive sequence]], meaning similar short reads could come from completely different parts of the sequence. | |||
Many overlapping reads for each segment of the original DNA are necessary to overcome these difficulties and accurately assemble the sequence. For example, to complete the [[Human Genome Project]], most of the human genome was sequenced at 12X or greater ''coverage''; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the ([[Euchromatin|euchromatic]]) human genome.{{Citation needed|date=November 2011}} | |||
==Whole genome shotgun sequencing== | |||
Whole genome shotgun sequencing for small (4000 to 7000 basepair) genomes was already in use in 1979.<ref name=Staden /> Broader application benefited from [[DNA_sequencing_theory#Pairwise_end-sequencing|pairwise end sequencing]], known colloquially as ''double-barrel shotgun sequencing''. As sequencing projects began to take on longer and more complicated DNAs, multiple groups began to realize that useful information could be obtained by sequencing both ends of a fragment of DNA. Although sequencing both ends of the same fragment and keeping track of the paired data was more cumbersome than sequencing a single end of two distinct fragments, the knowledge that the two sequences were oriented in opposite directions and were about the length of a fragment apart from each other was valuable in reconstructing the sequence of the original target fragment. The first published description of the use of paired ends was in 1990<ref>{{cite journal | |||
| last = Edwards | |||
| first = A | |||
| coauthors = Caskey, T | |||
| title = Closure strategies for random DNA sequencing | |||
| journal = Methods: A Companion to Methods in Enzymology | |||
| volume = 3 | |||
| issue = 1 | |||
| pages = 41–47 | |||
| year = 1991 | |||
| doi = 10.1016/S1046-2023(05)80162-8 }}</ref> | |||
as part of the sequencing of the human [[Hypoxanthine-guanine phosphoribosyltransferase|HGPRT]] locus, although the use of paired ends was limited to closing gaps after the application of a traditional shotgun sequencing approach. The first theoretical description of a pure pairwise end sequencing strategy, assuming fragments of constant length, was in 1991.<ref>{{cite journal | |||
| last = Edwards | |||
| first = A | |||
| coauthors = Voss, H.; Rice, P.; Civitello, A.; Stegemann, J.; Schwager, C.; Zimmerman, J.; Erfle, H.; Caskey, T.; Ansorge, W. | |||
| title = Automated DNA sequencing of the human HPRT locus | |||
| journal = Genomics | |||
| volume = 6 | |||
| pages = 593–608 | |||
| year = 1990 | |||
| pmid = 2341149 | |||
| doi = 10.1016/0888-7543(90)90493-E | |||
| issue = 4 }} | |||
</ref> At the time, there was community consensus that the optimal fragment length for pairwise end sequencing would be three times the sequence read length. In 1995 Roach et al.<ref>{{cite journal | |||
| last = Roach | |||
| first = JC | |||
| coauthors = Boysen, C; Wang, K; Hood, L | |||
| title = Pairwise end sequencing: a unified approach to genomic mapping and sequencing | |||
| journal = Genomics | |||
| volume = 26 | |||
| pages = 345–353 | |||
| year = 1995 | |||
| pmid = 7601461 | |||
| doi = 10.1016/0888-7543(95)80219-C | |||
| issue = 2 }}</ref> | |||
introduced the innovation of using fragments of varying sizes, and demonstrated that a pure pairwise end-sequencing strategy would be possible on large targets. The strategy was subsequently adopted by [[The Institute for Genomic Research]] (TIGR) to sequence the genome of the bacterium ''[[Haemophilus influenzae]]'' in 1995,<ref>{{cite journal | |||
| last = Fleischmann | |||
| first = RD | |||
| coauthors = et al. | |||
| title = Whole-genome random sequencing and assembly of Haemophilus influenzae Rd | |||
| journal = Science | |||
| volume = 269 | |||
| issue = 5223 | |||
| pages = 496–512 | |||
| year = 1995 | |||
| pmid = 7542800 | |||
| doi = 10.1126/science.7542800 |bibcode = 1995Sci...269..496F }}</ref> and then by [[Celera Genomics]] to sequence the ''[[Drosophila melanogaster]]'' (fruit fly) genome in 2000,<ref>{{cite journal | |||
| last = Adams | |||
| first = MD | |||
| coauthors = et al. | |||
| title = The genome sequence of Drosophila melanogaster | |||
| journal = Science | |||
| volume = 287 | |||
| issue = 5461 | |||
| pages = 2185–95 | |||
| year = 2000 | |||
| pmid = 10731132 | doi = 10.1126/science.287.5461.2185 | |||
| bibcode=2000Sci...287.2185.}}</ref> | |||
and subsequently the human genome. | |||
To apply the strategy, high-molecular-weight DNA is sheared into random fragments, size-selected (usually 2, 10, 50, and 150 kb), and [[clone (genetics)|clone]]d into an appropriate [[vector DNA|vector]]. The clones are then sequenced from both ends using the [[chain termination method]] yielding two short sequences. Each sequence is called an ''end-read'' or ''read'' and two reads from the same clone are referred to as ''[[Paired-end Tags|mate pairs]]''. Since the chain termination method usually can only produce reads between 500 and 1000 bases long, in all but the smallest clones, [[Paired-end Tags|mate pairs]] will rarely overlap. | |||
The original sequence is reconstructed from the reads using sequence assembly [[software]]. First, overlapping reads are collected into longer composite sequences known as ''[[contig]]s''. Contigs can be linked together into ''scaffolds'' by following connections between [[Paired-end Tags|mate pairs]]. The distance between contigs can be inferred from the [[Paired-end Tags|mate pair]] positions if the average fragment length of the library is known and has a narrow window of deviation. Depending on the size of the gap between contigs, different techniques can be used to find the sequence in the gaps. If the gap is small (5-20kb) then the use of PCR to amplify the region is required, followed by sequencing. If the gap is large (>20kb) then the large fragment is cloned in special vectors such as BAC ([[Bacterial artificial chromosome]]s) followed by sequencing of the vector. | |||
Proponents of this approach argue that it is possible to sequence the whole [[genome]] at once using large arrays of sequencers, which makes the whole process much more efficient than more traditional approaches. Detractors argue that although the technique quickly sequences large regions of DNA, its ability to correctly link these regions is suspect, particularly for genomes with repeating regions. As [[sequence assembly]] programs become more sophisticated and computing power becomes cheaper, it may be possible to overcome this limitation.{{Citation needed|date=February 2007}} | |||
===Coverage=== | |||
Coverage (read depth or depth) is the average number of reads representing a given [[nucleotide]] in the reconstructed sequence. It can be calculated from the length of the original genome (''G''), the number of reads(''N''), and the average read length(''L'') as <math>N\times L/G</math>. For example, a hypothetical genome with 2,000 base pairs reconstructed from 8 reads with an average length of 500 nucleotides will have 2x redundancy. This parameter also enables one to estimate other quantities, such as the percentage of the genome covered by reads (sometimes also called coverage). A high coverage in shotgun sequencing is desired because it can overcome errors in base calling and assembly. The subject of [[DNA sequencing theory]] addresses the relationships of such quantities. | |||
Sometimes a distinction is made between sequence coverage and physical coverage. Sequence coverage is the average number of times a base is read (as described above). Physical coverage is the average number of times a base is read or spanned by mate paired reads.<ref name="MeyersonFig1">{{cite doi|10.1038/nrg2841}}</ref> | |||
==Hierarchical Shotgun sequencing== | |||
[[File:Whole genome shotgun sequencing versus Hierarchical shotgun sequencing.png|thumb| In whole genome shotgun sequencing (top), the entire genome is sheared randomly into small fragments (appropriately sized for sequencing) and then reassembled. In hierarchical shotgun sequencing (bottom), the genome is first broken into larger segments. After the order of these segments is deduced, they are further sheared into fragments appropriately sized for sequencing.]] | |||
Although shotgun sequencing can in theory be applied to a genome of any size, its direct application to the sequencing of large genomes (for instance, the [[Human Genome]]) was limited until the late 1990s, when technological advances made practical the handling of the vast quantities of complex data involved in the process.<ref name="genome sequencing">Dunham, I. ''Genome Sequencing''. Encyclopedia of Life Sciences, 2005. {{doi|10.1038/npg.els.0005378}}</ref> Historically, full-genome shotgun sequencing was believed to be limited by both the sheer size of large genomes and by the complexity added by the high percentage of repetitive DNA (greater than 50% for the human genome) present in large genomes.<ref name="venter">Venter, J. C. ‘’Shotgunning the Human Genome: A Personal View.’’ Encyclopedia of Life Sciences, 2006.</ref> It was not widely accepted that a full-genome shotgun sequence of a large genome would provide reliable data. For these reasons, other strategies that lowered the computational load of sequence assembly had to be utilized before shotgun sequencing was performed.<ref name="venter" /> | |||
In hierarchical sequencing, also known as top-down sequencing, a low-resolution [[Gene mapping#Physical Mapping|physical map]] of the genome is made prior to actual sequencing. From this map, a minimal number of fragments that cover the entire chromosome are selected for sequencing.<ref name="textbook">Gibson, G. and Muse, S. V. ''A Primer of Genome Science''. 3rd ed. P.84</ref> In this way, the minimum amount of high-throughput sequencing and assembly is required. | |||
The amplified genome is first sheared into larger pieces (50-200kb) and cloned into a bacterial host using [[Bacterial artificial chromosome|BACs]] or [[P1-derived artificial chromosome|PACs]]. Because multiple genome copies have been sheared at random, the fragments contained in these clones have different ends, and with enough coverage (see section above) finding a '''scaffold''' of [[Contig#BAC contigs|BAC contigs]] that covers the entire genome is theoretically possible. This scaffold is called a '''tiling path'''.[[File:Tiling path.png|thumb|A BAC contig that covers the entire genomic area of interest makes up the tiling path.]] Once a tiling path has been found, the BACs that form this path are sheared at random into smaller fragments and can be sequenced using the shotgun method on a smaller scale. | |||
Although the full sequences of the BAC contigs is not known, their orientations relative to one another are known. There are several methods for deducing this order and selecting the BACs that make up a tiling path. The general strategy involves identifying the positions of the clones relative to one another and then selecting the least number of clones required to form a contiguous scaffold that covers the entire area of interest. The order of the clones is deduced by determining the way in which they overlap.<ref name="genome map">Dear, P. H. ''Genome Mapping''. Encyclopedia of Life Sciences, 2005. {{doi|10.1038/npg.els.0005353}}.</ref> Overlapping clones can be identified in several ways. A small radioactively or chemically labeled probe containing a [[sequence-tagged site]] (STS) can be hybridized onto a microarray upon which the clones are printed.<ref name="genome map" /> In this way, all the clones that contain a particular sequence in the genome are identified. The end of one of these clones can then be sequenced to yield a new probe and the process repeated in a method called chromosome walking. Alternatively, the BAC [[BAC library#Genomic libraries|library]] can be restriction-digested. Two clones that have several fragment sizes in common are inferred to overlap because they contain multiple similarly spaced restriction sites in common.<ref name="genome map" /> This method of genomic mapping is called restriction fingerprinting because it identifies a set of restriction sites contained in each clone. Once the overlap between the clones has been found and their order relative to the genome known, a scaffold of a minimal subset of these contigs that covers the entire genome is shotgun-sequenced.<ref name="textbook" /> | |||
Because it involves first creating a low-resolution map of the genome, hierarchical shotgun sequencing is slower than whole-genome shotgun sequencing but relies less heavily on computer algorithms for genome assembly than whole-genome shotgun sequencing. The process of extensive BAC library creation and tiling path selection, however, make hierarchical shotgun sequencing slow and labor intensive. Now that the technology is available and the reliability of the data demonstrated,<ref name="venter" /> the speed and cost efficiency of whole-genome shotgun sequencing has made it the primary method for genome sequencing. | |||
==Shotgun and Next-generation sequencing== | |||
The classical shotgun sequencing was based on the Sanger sequencing method: this was the most advanced technique for sequencing genomes from about 1995–2005. The shotgun strategy is still applied today, however using other sequencing technologies, called [[DNA_sequencing#Next-generation_methods|next-generation sequencing]]. These technologies produce shorter reads (anywhere from 25–500bp) but many hundreds of thousands or millions of reads in a relatively short time (on the order of a day).<ref>{{cite journal | |||
| last = Karl | |||
| first = V | |||
| coauthors = et al | |||
| title = Next Generation Sequencing: From Basic Research to Diagnostics | |||
| journal = Clinical Chemistry | |||
| volume = 55 | |||
| issue = 4 | |||
| pages = 41–47 | |||
| year = 2009 | |||
| pmid = 19246620 | |||
| doi = 10.1373/clinchem.2008.112789 }}</ref> | |||
This results in high coverage, but the assembly process is much more computationally expensive. These technologies are vastly superior to Sanger sequencing due to the high volume of data and the relatively short time it takes to sequence a whole genome.<ref>{{cite journal | |||
| last = Metzker | |||
| first = Michael L. | |||
| title = Sequencing technologies - the next generation | |||
| journal = Nat Rev Genet | |||
| volume = 11 | |||
| issue = 1 | |||
| pages = 31–46 | |||
| year = 2010 | |||
| pmid = 19997069 | |||
| doi = 10.1038/nrg2626 }}</ref> | |||
==See also== | |||
*[[DNA sequencing theory]] | |||
==References== | |||
{{Reflist|30em}} | |||
===Further reading=== | |||
{{Refbegin}} | |||
*{{cite web | title=Shotgun sequencing comes of age | work=The Scientist | url=http://www.the-scientist.com/news/20021231/06 | accessdate=December 31, 2002}} | |||
*{{cite web | title=Shotgun sequencing finds nanoorganisms - Probe of acid mine drainage turns up unsuspected virus-sized Archaea | |||
| work=SpaceRef.com| url=http://www.spaceref.com/news/viewpr.html?pid=21532 | |||
| accessdate=December 23, 2006}} | |||
*{{cite web | title=Genomic shotgun sequencing | work=biology science | url=http://www.cd-genomics.com/gene/shotgun.htm | accessdate=April 11, 2009}} | |||
{{Refend}} | |||
==External links== | |||
{{NCBI-handbook}} | |||
{{DEFAULTSORT:Shotgun Sequencing}} | |||
[[Category:Molecular biology]] | |||
[[Category:DNA sequencing]] | |||
Revision as of 17:34, 3 February 2014
In genetics, shotgun sequencing, also known as shotgun cloning, is a method used for sequencing long DNA strands. It is named by analogy with the rapidly expanding, quasi-random firing pattern of a shotgun.
Since the chain termination method of DNA sequencing can only be used for fairly short strands (100 to 1000 basepairs), longer sequences must be subdivided into smaller fragments, and subsequently re-assembled to give the overall sequence. Two principal methods are used for this: chromosome walking, which progresses through the entire strand, piece by piece, and shotgun sequencing, which is a faster but more complex process, and uses random fragments.
In shotgun sequencing,[1][2] DNA is broken up randomly into numerous small segments, which are sequenced using the chain termination method to obtain reads. Multiple overlapping reads for the target DNA are obtained by performing several rounds of this fragmentation and sequencing. Computer programs then use the overlapping ends of different reads to assemble them into a continuous sequence.[1]
Shotgun sequencing was one of the precursor technologies that was responsible for enabling full genome sequencing.
Example
For example, consider the following two rounds of shotgun reads:
| Strand | Sequence |
|---|---|
| Original | AGCATGCTGCAGTCATGCTTAGGCTA
|
| First shotgun sequence | AGCATGCTGCAGTCATGCT-------
|
| Second shotgun sequence | AGCATG--------------------
|
| Reconstruction | AGCATGCTGCAGTCATGCTTAGGCTA
|
In this extremely simplified example, none of the reads cover the full length of the original sequence, but the four reads can be assembled into the original sequence using the overlap of their ends to align and order them. In reality, this process uses enormous amounts of information that are rife with ambiguities and sequencing errors. Assembly of complex genomes is additionally complicated by the great abundance of repetitive sequence, meaning similar short reads could come from completely different parts of the sequence.
Many overlapping reads for each segment of the original DNA are necessary to overcome these difficulties and accurately assemble the sequence. For example, to complete the Human Genome Project, most of the human genome was sequenced at 12X or greater coverage; that is, each base in the final sequence was present, on average, in 12 reads. Even so, current methods have failed to isolate or assemble reliable sequence for approximately 1% of the (euchromatic) human genome.Potter or Ceramic Artist Truman Bedell from Rexton, has interests which include ceramics, best property developers in singapore developers in singapore and scrabble. Was especially enthused after visiting Alejandro de Humboldt National Park.
Whole genome shotgun sequencing
Whole genome shotgun sequencing for small (4000 to 7000 basepair) genomes was already in use in 1979.[1] Broader application benefited from pairwise end sequencing, known colloquially as double-barrel shotgun sequencing. As sequencing projects began to take on longer and more complicated DNAs, multiple groups began to realize that useful information could be obtained by sequencing both ends of a fragment of DNA. Although sequencing both ends of the same fragment and keeping track of the paired data was more cumbersome than sequencing a single end of two distinct fragments, the knowledge that the two sequences were oriented in opposite directions and were about the length of a fragment apart from each other was valuable in reconstructing the sequence of the original target fragment. The first published description of the use of paired ends was in 1990[3] as part of the sequencing of the human HGPRT locus, although the use of paired ends was limited to closing gaps after the application of a traditional shotgun sequencing approach. The first theoretical description of a pure pairwise end sequencing strategy, assuming fragments of constant length, was in 1991.[4] At the time, there was community consensus that the optimal fragment length for pairwise end sequencing would be three times the sequence read length. In 1995 Roach et al.[5] introduced the innovation of using fragments of varying sizes, and demonstrated that a pure pairwise end-sequencing strategy would be possible on large targets. The strategy was subsequently adopted by The Institute for Genomic Research (TIGR) to sequence the genome of the bacterium Haemophilus influenzae in 1995,[6] and then by Celera Genomics to sequence the Drosophila melanogaster (fruit fly) genome in 2000,[7] and subsequently the human genome.
To apply the strategy, high-molecular-weight DNA is sheared into random fragments, size-selected (usually 2, 10, 50, and 150 kb), and cloned into an appropriate vector. The clones are then sequenced from both ends using the chain termination method yielding two short sequences. Each sequence is called an end-read or read and two reads from the same clone are referred to as mate pairs. Since the chain termination method usually can only produce reads between 500 and 1000 bases long, in all but the smallest clones, mate pairs will rarely overlap.
The original sequence is reconstructed from the reads using sequence assembly software. First, overlapping reads are collected into longer composite sequences known as contigs. Contigs can be linked together into scaffolds by following connections between mate pairs. The distance between contigs can be inferred from the mate pair positions if the average fragment length of the library is known and has a narrow window of deviation. Depending on the size of the gap between contigs, different techniques can be used to find the sequence in the gaps. If the gap is small (5-20kb) then the use of PCR to amplify the region is required, followed by sequencing. If the gap is large (>20kb) then the large fragment is cloned in special vectors such as BAC (Bacterial artificial chromosomes) followed by sequencing of the vector.
Proponents of this approach argue that it is possible to sequence the whole genome at once using large arrays of sequencers, which makes the whole process much more efficient than more traditional approaches. Detractors argue that although the technique quickly sequences large regions of DNA, its ability to correctly link these regions is suspect, particularly for genomes with repeating regions. As sequence assembly programs become more sophisticated and computing power becomes cheaper, it may be possible to overcome this limitation.Potter or Ceramic Artist Truman Bedell from Rexton, has interests which include ceramics, best property developers in singapore developers in singapore and scrabble. Was especially enthused after visiting Alejandro de Humboldt National Park.
Coverage
Coverage (read depth or depth) is the average number of reads representing a given nucleotide in the reconstructed sequence. It can be calculated from the length of the original genome (G), the number of reads(N), and the average read length(L) as . For example, a hypothetical genome with 2,000 base pairs reconstructed from 8 reads with an average length of 500 nucleotides will have 2x redundancy. This parameter also enables one to estimate other quantities, such as the percentage of the genome covered by reads (sometimes also called coverage). A high coverage in shotgun sequencing is desired because it can overcome errors in base calling and assembly. The subject of DNA sequencing theory addresses the relationships of such quantities.
Sometimes a distinction is made between sequence coverage and physical coverage. Sequence coverage is the average number of times a base is read (as described above). Physical coverage is the average number of times a base is read or spanned by mate paired reads.[8]
Hierarchical Shotgun sequencing
Although shotgun sequencing can in theory be applied to a genome of any size, its direct application to the sequencing of large genomes (for instance, the Human Genome) was limited until the late 1990s, when technological advances made practical the handling of the vast quantities of complex data involved in the process.[9] Historically, full-genome shotgun sequencing was believed to be limited by both the sheer size of large genomes and by the complexity added by the high percentage of repetitive DNA (greater than 50% for the human genome) present in large genomes.[10] It was not widely accepted that a full-genome shotgun sequence of a large genome would provide reliable data. For these reasons, other strategies that lowered the computational load of sequence assembly had to be utilized before shotgun sequencing was performed.[10] In hierarchical sequencing, also known as top-down sequencing, a low-resolution physical map of the genome is made prior to actual sequencing. From this map, a minimal number of fragments that cover the entire chromosome are selected for sequencing.[11] In this way, the minimum amount of high-throughput sequencing and assembly is required.
The amplified genome is first sheared into larger pieces (50-200kb) and cloned into a bacterial host using BACs or PACs. Because multiple genome copies have been sheared at random, the fragments contained in these clones have different ends, and with enough coverage (see section above) finding a scaffold of BAC contigs that covers the entire genome is theoretically possible. This scaffold is called a tiling path.
Once a tiling path has been found, the BACs that form this path are sheared at random into smaller fragments and can be sequenced using the shotgun method on a smaller scale.
Although the full sequences of the BAC contigs is not known, their orientations relative to one another are known. There are several methods for deducing this order and selecting the BACs that make up a tiling path. The general strategy involves identifying the positions of the clones relative to one another and then selecting the least number of clones required to form a contiguous scaffold that covers the entire area of interest. The order of the clones is deduced by determining the way in which they overlap.[12] Overlapping clones can be identified in several ways. A small radioactively or chemically labeled probe containing a sequence-tagged site (STS) can be hybridized onto a microarray upon which the clones are printed.[12] In this way, all the clones that contain a particular sequence in the genome are identified. The end of one of these clones can then be sequenced to yield a new probe and the process repeated in a method called chromosome walking. Alternatively, the BAC library can be restriction-digested. Two clones that have several fragment sizes in common are inferred to overlap because they contain multiple similarly spaced restriction sites in common.[12] This method of genomic mapping is called restriction fingerprinting because it identifies a set of restriction sites contained in each clone. Once the overlap between the clones has been found and their order relative to the genome known, a scaffold of a minimal subset of these contigs that covers the entire genome is shotgun-sequenced.[11] Because it involves first creating a low-resolution map of the genome, hierarchical shotgun sequencing is slower than whole-genome shotgun sequencing but relies less heavily on computer algorithms for genome assembly than whole-genome shotgun sequencing. The process of extensive BAC library creation and tiling path selection, however, make hierarchical shotgun sequencing slow and labor intensive. Now that the technology is available and the reliability of the data demonstrated,[10] the speed and cost efficiency of whole-genome shotgun sequencing has made it the primary method for genome sequencing.
Shotgun and Next-generation sequencing
The classical shotgun sequencing was based on the Sanger sequencing method: this was the most advanced technique for sequencing genomes from about 1995–2005. The shotgun strategy is still applied today, however using other sequencing technologies, called next-generation sequencing. These technologies produce shorter reads (anywhere from 25–500bp) but many hundreds of thousands or millions of reads in a relatively short time (on the order of a day).[13] This results in high coverage, but the assembly process is much more computationally expensive. These technologies are vastly superior to Sanger sequencing due to the high volume of data and the relatively short time it takes to sequence a whole genome.[14]
See also
References
43 year old Petroleum Engineer Harry from Deep River, usually spends time with hobbies and interests like renting movies, property developers in singapore new condominium and vehicle racing. Constantly enjoys going to destinations like Camino Real de Tierra Adentro.
Further reading
External links
Before you resolve whether stainless-steel cookware is price buying, lets first focus on what chrome steel cookware is. Stainless steel is made of an alloy, or a combination of metals. Mostly, primary iron with chromium, nickel or another minor metals. The chromium supplies rust protection and gives your cookware sturdiness. The nickel gives rust protection as nicely, and provides a polished look. Most properly made stainless steel cookware has copper or aluminum added to the bottom of the pan or pot. This is done to increases the power of the pot or pan to conduct warmth.
The most effective stainless-steel cookware is the principle category, but still it is divided into a number of subcategories primarily based on the standard and the value range. It can be complicated to decide on the perfect chrome steel cookware out of the classes that may meet your requirements. This is where we took a step ahead to clarify you all the data that might be useful for you to understand how to decide on the very best chrome steel cookware. One of the best chrome steel cookware set is manufactured from low-cost to costly and quality constructed pots and pans.
You will find magnetic stainless steel within the layer on the skin of some quality pieces of chrome steel. That is to make it appropriate with induction stovetops, which contain the use of a rapidly charging electromagnetic discipline to warmth cookware. High-high quality chrome steel, like All-Clad , uses three layers of metal—the austenite layer of steel on the inside, ferrite steel on the outside, and a layer of aluminum sandwiched between the two for optimum warmth conductivity (metal alone does not conduct warmth evenly). Lesser-quality stainless-steel is often just one layer of austenitic stainless-steel.
Aesthetically talking, chrome steel is a sensible choice in case you prefer to display or dangle pots or pans. The clear, crisp look of all chrome steel kitchenware can remodel a mishmash of cookware into a complicated décor assertion. Chrome steel kettles, such as the Cuisinart Tea Kettle will mix particular person kitchenware into a cohesive and pleasant entity. Consider buying stainless steel utensils as well. Already acquired a stunning stainless-steel cookware collection? The Cuisinart Chef’s Collection stainless pot rack might be the finishing touch for a kitchen, releasing up house and making these pots and pans readily accessible. Get the stainless steel cookware of your culinary dreams at Macy’s!
Laborious-anodized aluminum cookware is among the most popular sorts of material, though many people do not fairly understand the construction. Laborious-anodized aluminum is plain aluminum that has been processed in a series of chemical baths charged with an electric current. The result is a material that has the same superior heat conductivity as aluminum however is non-reactive with acidic meals, corresponding to tomatoes, and twice as laborious as stainless-steel. Two drawbacks to hard-anodized cookware are that it isn't dishwasher-secure and, as a result of it isn't magnetic, it won't work with induction range tops.
If you liked this write-up and you would certainly like to receive even more info concerning stainless steel cookware reviews kindly check out our internet site. The enamel over steel technique creates a bit that has the warmth distribution of carbon steel and a non-reactive, low-stick surface. Such pots are a lot lighter than most other pots of comparable size, are cheaper to make than chrome steel pots, and do not need the rust and reactivity problems with cast iron or carbon metal. quotation wanted Enamel over metal is ideal for big stockpots and for different large pans used principally for water-primarily based cooking. Because of its gentle weight and easy cleanup, enamel over metal can also be popular for cookware used while tenting. Clad aluminium or copper edit
Distinctive specialty cookware pieces served a la carte to compliment any cookware set are constructed of a durable Stainless Metal with a brushed exterior end. Designed with an affect bonded, aluminum disk encapsulated base which distributes heat shortly and evenly to allow exact temperature control. Handles are riveted for durability and performance. The New Specialty Cookware is appropriate for all vary types together with induction. In addition to the multi use function, another unique feature is backside to top interior volume markings in each quarts and metric measurement; and each piece comes with a tempered glass lid, oven secure to 350°F.
Whether you're a cooking fans, knowledgeable chef or just cooking for your loved ones you recognize the significance of having a totally stocked kitchen. Not solely do you need the right elements, but you also need the right tools to get the job carried out. In any kind of basic cooking training lesson, you will learn that stainless-steel is your new best pal in terms of kitchen cookware. What additionally, you will study is that quality cooking tools doesn't normally come at a reduced worth. For that reason, you will need to take excellent care of your cookware! Listed here are some basics for chrome steel care.
To combat the uneven heating problem, most stainless-steel pans are laminations of aluminum or copper on the underside to unfold the heat around, and stainless steel inside the pan to provide a cooking floor that is impervious to no matter you may put inside. In my experience, this stainless steel floor is still too sticky to fry on, and in case you ever burn it you get a everlasting hassle spot. However, sometimes a stainless-steel cooking surface turns out to be useful when you possibly can't use aluminum (see beneath) so I keep some around. Select one thing with a fairly thick aluminum layer on the underside.
Properly, except you’re a metals expert and go inspect the manufacturing unit where the metal is made to see whether or not or not their manufacturing process creates a pure austenite without corrosive materials shaped, you’re not going to know for sure whether or not the craftsmanship of your stainless is of the very best high quality. I feel your best guess is to easily purchase excessive-high quality stainless steel from the beginning, from a model with a repute for good high quality. However, I think I have found out one way you could decide if the stainless cookware you have already got is potentially reactive.
- ↑ 1.0 1.1 1.2 One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ Template:Cite doi
- ↑ Dunham, I. Genome Sequencing. Encyclopedia of Life Sciences, 2005. 21 year-old Glazier James Grippo from Edam, enjoys hang gliding, industrial property developers in singapore developers in singapore and camping. Finds the entire world an motivating place we have spent 4 months at Alejandro de Humboldt National Park.
- ↑ 10.0 10.1 10.2 Venter, J. C. ‘’Shotgunning the Human Genome: A Personal View.’’ Encyclopedia of Life Sciences, 2006.
- ↑ 11.0 11.1 Gibson, G. and Muse, S. V. A Primer of Genome Science. 3rd ed. P.84
- ↑ 12.0 12.1 12.2 Dear, P. H. Genome Mapping. Encyclopedia of Life Sciences, 2005. 21 year-old Glazier James Grippo from Edam, enjoys hang gliding, industrial property developers in singapore developers in singapore and camping. Finds the entire world an motivating place we have spent 4 months at Alejandro de Humboldt National Park..
- ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang - ↑ One of the biggest reasons investing in a Singapore new launch is an effective things is as a result of it is doable to be lent massive quantities of money at very low interest rates that you should utilize to purchase it. Then, if property values continue to go up, then you'll get a really high return on funding (ROI). Simply make sure you purchase one of the higher properties, reminiscent of the ones at Fernvale the Riverbank or any Singapore landed property Get Earnings by means of Renting
In its statement, the singapore property listing - website link, government claimed that the majority citizens buying their first residence won't be hurt by the new measures. Some concessions can even be prolonged to chose teams of consumers, similar to married couples with a minimum of one Singaporean partner who are purchasing their second property so long as they intend to promote their first residential property. Lower the LTV limit on housing loans granted by monetary establishments regulated by MAS from 70% to 60% for property purchasers who are individuals with a number of outstanding housing loans on the time of the brand new housing purchase. Singapore Property Measures - 30 August 2010 The most popular seek for the number of bedrooms in Singapore is 4, followed by 2 and three. Lush Acres EC @ Sengkang
Discover out more about real estate funding in the area, together with info on international funding incentives and property possession. Many Singaporeans have been investing in property across the causeway in recent years, attracted by comparatively low prices. However, those who need to exit their investments quickly are likely to face significant challenges when trying to sell their property – and could finally be stuck with a property they can't sell. Career improvement programmes, in-house valuation, auctions and administrative help, venture advertising and marketing, skilled talks and traisning are continuously planned for the sales associates to help them obtain better outcomes for his or her shoppers while at Knight Frank Singapore. No change Present Rules
Extending the tax exemption would help. The exemption, which may be as a lot as $2 million per family, covers individuals who negotiate a principal reduction on their existing mortgage, sell their house short (i.e., for lower than the excellent loans), or take part in a foreclosure course of. An extension of theexemption would seem like a common-sense means to assist stabilize the housing market, but the political turmoil around the fiscal-cliff negotiations means widespread sense could not win out. Home Minority Chief Nancy Pelosi (D-Calif.) believes that the mortgage relief provision will be on the table during the grand-cut price talks, in response to communications director Nadeam Elshami. Buying or promoting of blue mild bulbs is unlawful.
A vendor's stamp duty has been launched on industrial property for the primary time, at rates ranging from 5 per cent to 15 per cent. The Authorities might be trying to reassure the market that they aren't in opposition to foreigners and PRs investing in Singapore's property market. They imposed these measures because of extenuating components available in the market." The sale of new dual-key EC models will even be restricted to multi-generational households only. The models have two separate entrances, permitting grandparents, for example, to dwell separately. The vendor's stamp obligation takes effect right this moment and applies to industrial property and plots which might be offered inside three years of the date of buy. JLL named Best Performing Property Brand for second year running
The data offered is for normal info purposes only and isn't supposed to be personalised investment or monetary advice. Motley Fool Singapore contributor Stanley Lim would not personal shares in any corporations talked about. Singapore private home costs increased by 1.eight% within the fourth quarter of 2012, up from 0.6% within the earlier quarter. Resale prices of government-built HDB residences which are usually bought by Singaporeans, elevated by 2.5%, quarter on quarter, the quickest acquire in five quarters. And industrial property, prices are actually double the levels of three years ago. No withholding tax in the event you sell your property. All your local information regarding vital HDB policies, condominium launches, land growth, commercial property and more
There are various methods to go about discovering the precise property. Some local newspapers (together with the Straits Instances ) have categorised property sections and many local property brokers have websites. Now there are some specifics to consider when buying a 'new launch' rental. Intended use of the unit Every sale begins with 10 p.c low cost for finish of season sale; changes to 20 % discount storewide; follows by additional reduction of fiftyand ends with last discount of 70 % or extra. Typically there is even a warehouse sale or transferring out sale with huge mark-down of costs for stock clearance. Deborah Regulation from Expat Realtor shares her property market update, plus prime rental residences and houses at the moment available to lease Esparina EC @ Sengkang