|
|
| Line 1: |
Line 1: |
| '''FASTQ format''' is a text-based [[File format|format]] for storing both a biological sequence (usually [[nucleotide sequence]]) and its corresponding quality scores. Both the sequence letter and quality score are encoded with a single [[ASCII]] character for brevity. It was originally developed at the [[Wellcome Trust Sanger Institute]] to bundle a [[FASTA format|FASTA]] sequence and its quality data, but has recently become the ''de facto'' standard for storing the output of high throughput sequencing instruments such as the [[Illumina (company)|Illumina Genome Analyzer]].<ref name="Cock et al 2009">Cock et al (2009) The Sanger FASTQ file format for sequences with quality scores, and the Solexa/Illumina FASTQ variants. Nucleic Acids Research, {{doi|10.1093/nar/gkp1137}}</ref>
| |
|
| |
|
| ==Format==
| |
|
| |
|
| A FASTQ file normally uses four lines per sequence.
| | Many businessmen and sales agents struggle with [http://Www.Adobe.com/cfusion/search/index.cfm?term=&generating+leads&loc=en_us&siteSection=home generating leads]. Some complicate the process while others spend their time in search of the secret formula or magic topic. Cutting corners and searching for short cuts will just waste your energy.<br><br>He accomplishes this by with instructions on how to build sales funnels in your marketing campaigns. Once in place, you can direct that traffic to the opportunity (MLM, affiliate product, etc.,). They also need to get built the simplest way. Jonathan shows you how to obtain the biggest impact for your determination.<br><br>We were talking on what you could start while using small end of product sales funnel - the expensive product rather than the big end, with the freebie along with $10 product, and then design whole sales funnel to push towards this big product, instead of creating bigger and larger products.<br><br>Are just small an entrepreneur or a startup guru? Do you sell local services or do you ship everywhere around the world? Do you depend on online lead generation or sales or want a website for branding purposes? Is that going as a major or critical website or just minisite among many other things? How long will it get in use a year, several years or as long as possible?<br><br>If you want a better response from your readers, something else you is capable of doing is offer them a bribe, something like that for completely. Just convince people that the giving them something useful free of charge, and they'll be delighted to accept. It is a great to be able to get more subscribers on your own email checklist. You can actually benefit as a result in two different suggestions.<br><br>If your internal dialogue begins to resemble a needle stuck on a record, and also find yourself repeating a detrimental scenario, distracting yourself for 8 minutes will offer you relief may possibly help you interrupt your negative self-talk according to author Dr. Susan Nolen-Hoeksema, Ph.D., Women who Think A great deal of. Exaggerating the situation until absolutely find humor in the absurdity of your thinking is yet way to combat negative ruminating and be accepted as more resilient, says Karen Reivich, Ph.D., coauthor of The Resilience Factor.<br><br>Another proven email marketing technique is personalizing emails by using people's first names. Nothing is more vital that a person than specific name. Carry out using your contact's name in subject of line and body of the email, realizing what's good get effortless reading and responding for one's emails. A person are want much less reading your emails also higher click through rate, make sure you accomplish that. Everyone wants to feel unique and in contrast to an anonymous "friend" or "marketer." Your goals should be to develop long lasting connections with folks on your email list, as this will give you the best results.<br><br>If you have just about any inquiries about exactly where in addition to the way to work with full rss feed; [http://schooltechsupply.com/ForumRetrieve.aspx?ForumID=3226&TopicID=472585&NoTemplate=False http://schooltechsupply.com/],, you are able to email us from our web site. |
| * Line 1 begins with a '@' character and is followed by a sequence identifier and an ''optional'' description (like a [[FASTA format|FASTA]] title line).
| |
| * Line 2 is the raw sequence letters.
| |
| * Line 3 begins with a '+' character and is ''optionally'' followed by the same sequence identifier (and any description) again.
| |
| * Line 4 encodes the quality values for the sequence in Line 2, and must contain the same number of symbols as letters in the sequence.
| |
| | |
| A FASTQ file containing a single sequence might look like this:
| |
| | |
| <pre>
| |
| @SEQ_ID
| |
| GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
| |
| +
| |
| !''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
| |
| </pre>
| |
| | |
| The character '!' represents the lowest quality while '~' is the highest. Here are the quality value characters in left-to-right increasing order of quality ([[ASCII]]):
| |
| <pre>
| |
| !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
| |
| </pre>
| |
| | |
| The original Sanger FASTQ files also allowed the sequence and quality strings to be wrapped (split over multiple lines), but this is generally discouraged as it can make parsing complicated due to the unfortunate choice of "@" and "+" as markers (these characters can also occur in the quality string).
| |
| | |
| ===Illumina sequence identifiers=== | |
| | |
| Sequences from the [[Solexa|Illumina]] software use a systematic identifier:
| |
| | |
| <pre>
| |
| @HWUSI-EAS100R:6:73:941:1973#0/1
| |
| </pre>
| |
| {| class='wikitable'
| |
| |-
| |
| ! HWUSI-EAS100R
| |
| | the unique instrument name
| |
| |-
| |
| ! 6
| |
| | flowcell lane
| |
| |-
| |
| ! 73
| |
| | tile number within the flowcell lane
| |
| |-
| |
| ! 941
| |
| | 'x'-coordinate of the cluster within the tile
| |
| |-
| |
| ! 1973
| |
| | 'y'-coordinate of the cluster within the tile
| |
| |-
| |
| ! #0
| |
| | index number for a multiplexed sample (0 for no indexing)
| |
| |-
| |
| ! /1
| |
| | the member of a pair, /1 or /2 ''(paired-end or mate-pair reads only)''
| |
| |}
| |
| | |
| Versions of the Illumina pipeline since 1.4 appear to use '''#NNNNNN''' instead of '''#0''' for the multiplex ID, where '''NNNNNN''' is the sequence of the multiplex tag.
| |
| | |
| With Casava 1.8 the format of the '@' line has changed:
| |
| | |
| <pre> | |
| @EAS139:136:FC706VJ:2:2104:15343:197393 1:Y:18:ATCACG
| |
| </pre> | |
| {| class='wikitable'
| |
| |-
| |
| ! EAS139
| |
| | the unique instrument name
| |
| |-
| |
| ! 136
| |
| | the run id
| |
| |-
| |
| ! FC706VJ
| |
| | the flowcell id
| |
| |-
| |
| ! 2
| |
| | flowcell lane
| |
| |-
| |
| ! 2104
| |
| | tile number within the flowcell lane
| |
| |-
| |
| ! 15343
| |
| | 'x'-coordinate of the cluster within the tile
| |
| |-
| |
| ! 197393
| |
| | 'y'-coordinate of the cluster within the tile
| |
| |-
| |
| ! 1
| |
| | the member of a pair, 1 or 2 ''(paired-end or mate-pair reads only)''
| |
| |-
| |
| ! Y
| |
| | Y if the read fails filter (read is bad), N otherwise
| |
| |-
| |
| ! 18
| |
| | 0 when none of the control bits are on, otherwise it is an even number
| |
| |-
| |
| ! ATCACG
| |
| | index sequence
| |
| |}
| |
| | |
| ===NCBI Sequence Read Archive===
| |
| | |
| FASTQ files from the [[National Center for Biotechnology Information|NCBI]]/[[European Bioinformatics Institute|EBI]] [[Sequence Read Archive]] often include a description, e.g.
| |
| | |
| <pre>
| |
| @SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
| |
| GGGTGATGGCCGCTGCCGATGGCGTCAAATCCCACC
| |
| +SRR001666.1 071112_SLXA-EAS1_s_7:5:1:817:345 length=36
| |
| IIIIIIIIIIIIIIIIIIIIIIIIIIIIII9IG9IC
| |
| </pre>
| |
| | |
| In this example there is an NCBI-assigned identifier, and the description holds the original identifier from [[Solexa|Solexa/Illumina]] (as described above) plus the read length.
| |
| | |
| Also note that the NCBI have converted this FASTQ data from the original Solexa/Illumina encoding to the Sanger standard (see encodings below).
| |
| | |
| ==Variations==
| |
| | |
| ===Quality===
| |
| A quality value ''Q'' is an integer mapping of ''p'' (i.e., the probability that the corresponding base call is incorrect). Two different equations have been in use. The first is the standard Sanger variant to assess reliability of a base call, otherwise known as [[Phred quality score]]:
| |
| | |
| <math>Q_\text{sanger} = -10 \, \log_{10} p</math> | |
| | |
| The Solexa pipeline (i.e., the software delivered with the Illumina Genome Analyzer) earlier used a different mapping, encoding the [[odds]] ''p''/(1-''p'') instead of the probability ''p'':
| |
| | |
| <math>Q_\text{solexa-prior to v.1.3} = -10 \, \log_{10} \frac{p}{1-p}</math> | |
|
| |
| Although both mappings are asymptotically identical at higher quality values, they differ at lower quality levels (i.e., approximately ''p'' > 0.05, or equivalently, ''Q'' < 13).
| |
| | |
| [[File:Probability metrics.svg|thumb|left|600px|alt=Relationship between Q and p|Relationship between ''Q'' and ''p'' using the Sanger (red) and Solexa (black) equations (described above). The vertical dotted line indicates ''p'' = 0.05, or equivalently, ''Q'' ≈ 13.]]
| |
| {{-}}
| |
| | |
| At times there has been disagreement about which mapping Illumina actually uses. The user guide (Appendix B, page 122) for version 1.4 of the Illumina pipeline states that: "The scores are defined as Q=10*log10(p/(1-p)) {{sic}}, where p is the probability of a base call corresponding to the base in question".<ref name="Illumina User Guide 1.4">Sequencing Analysis Software User Guide: For Pipeline Version 1.4 and CASAVA Version 1.0, dated April 2009 [http://genomecenter.ucdavis.edu/dna_technologies/documents/pipeline_1_4.pdf PDF]</ref> In retrospect, this entry in the manual appears to have been an error. The user guide (What's New, page 5) for version 1.5 of the Illumina pipeline lists this description instead: "Important Changes in Pipeline v1.3 {{sic}}. The quality scoring scheme has changed to the Phred [i.e., Sanger] scoring scheme, encoded as an ASCII character by adding 64 to the Phred value. A Phred score of a base is: <math>Q_\text{phred} = -10 \log_\text{10} e</math>, where ''e'' is the estimated probability of a base being wrong.<ref name="Illumina User Guide 1.5">Sequencing Analysis Software User Guide: For Pipeline Version 1.5 and CASAVA Version 1.0, dated August 2009 [http://illumina.ucr.edu/illumina_docs/Pipeline1.5/Pipeline1.5_CASAVA1.0_User_Guide_15006500_A.pdf PDF]</ref>
| |
| | |
| ===Encoding===
| |
| *Sanger format can encode a [[Phred quality score]] from 0 to 93 using ASCII 33 to 126 (although in raw read data the Phred quality score rarely exceeds 60, higher scores are possible in assemblies or read maps). Also used in SAM format.<ref name="Sequence/Alignment Map format">Sequence/Alignment Map format Version 1.0, dated August 2009 [http://samtools.sourceforge.net/SAM1.pdf PDF]</ref> Coming to the end of February 2011, Illumina's newest version (1.8) of their pipeline CASAVA will directly produce fastq in Sanger format, according to the announcement on seqanswers.com forum.<ref name="Upcoming changes in CASAVA topic">Seqanswer's topic of skruglyak, dated January 2011 [http://seqanswers.com/forums/showthread.php?s=ba8c7dfba863815f637c0bf45882f14b&t=8895 website]</ref>
| |
| *Solexa/Illumina 1.0 format can encode a Solexa/Illumina quality score from -5 to 62 using [[ASCII]] 59 to 126 (although in raw read data Solexa scores from -5 to 40 only are expected)
| |
| *Starting with Illumina 1.3 and before Illumina 1.8, the format encoded a [[Phred quality score]] from 0 to 62 using [[ASCII]] 64 to 126 (although in raw read data Phred scores from 0 to 40 only are expected).
| |
| *Starting in Illumina 1.5 and before Illumina 1.8, the Phred scores 0 to 2 have a slightly different meaning. The values 0 and 1 are no longer used and the value 2, encoded by ASCII 66 "B", is used also at the end of reads as a ''Read Segment Quality Control Indicator''.<ref>Illumina Quality Scores, Tobias Mann, Bioinformatics, San Diego, Illumina [http://seqanswers.com/forums/showthread.php?t=4721]</ref> The Illumina manual<ref>[Using Genome Analyzer
| |
| Sequencing Control Software, Version 2.6, Catalog # SY-960-2601, Part # 15009921 Rev. A, November 2009]http://watson.nci.nih.gov/solexa/Using_SCSv2.6_15009921_A.pdf</ref> (page 30) states the following: ''If a read ends with a segment of mostly low quality (Q15 or below), then all of the quality values in the segment are replaced with a value of 2 (encoded as the letter B in Illumina's text-based encoding of quality scores)... This Q2 indicator does not predict a specific error rate, but rather indicates that a specific final portion of the read should not be used in further analyses.'' Also, the quality score encoded as "B" letter may occur internally within reads at least as late as pipeline version 1.6, as shown in the following example:
| |
| | |
| <pre>
| |
| @HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
| |
| TTAATTGGTAAATAAATCTCCTAATAGCTTAGATNTTACCTTNNNNNNNNNNTAGTTTCTTGAGATTTGTTGGGGGAGACATTTTTGTGATTGCCTTGAT
| |
| +HWI-EAS209_0006_FC706VJ:5:58:5894:21141#ATCACG/1
| |
| efcfffffcfeefffcffffffddf`feed]`]_Ba_^__[YBBBBBBBBBBRTT\]][]dddd`ddd^dddadd^BBBBBBBBBBBBBBBBBBBBBBBB
| |
| </pre>
| |
| | |
| An alternative interpretation of this ASCII encoding has been proposed.<ref>[http://solexaqa.sourceforge.net/questions.htm#illumina SolexaQA project website]</ref> Also, in Illumina runs using PhiX controls, the character 'B' was observed to represent an "unknown quality score". The error rate of 'B' reads was roughly 3 phred scores lower the mean observed score of a given run.
| |
| | |
| *Starting in Illumina 1.8, the quality scores have basically returned to the use of the Sanger format (Phred+33).
| |
| | |
| For raw reads, the range of scores will depend on the technology and the base caller used, but will typically be up to 40. Recent Illumina chemistry changes have resulted in reported quality scores of 41, which has broken various scripts and tools expecting an upper bound of 40.
| |
| | |
| <span style="color: purple">SSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSSS</span>.....................................................
| |
| ..........................<span style="color: green">XXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXXX</span>......................
| |
| ...............................<span style="color: blue">IIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIIII</span>......................
| |
| .................................<span style="color: orange">'''J'''JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJ</span>......................
| |
| <span style="color: brown">..LLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLLL</span>....................................................
| |
| !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~
| |
| | | | | | |
| |
| 33 59 64 73 104 126
| |
| <span style="color: purple"> 0........................26...31.......40 </span>
| |
| <span style="color: green" > -5....0........9.............................40 </span>
| |
| <span style="color: blue" > 0........9.............................40 </span>
| |
| <span style="color: orange"> 3.....9.............................40 </span>
| |
| <span style="color: brown" > 0.2......................26...31........41 </span>
| |
|
| |
| <span style="color: purple">S - Sanger Phred+33, raw reads typically (0, 40)</span>
| |
| <span style="color: green" >X - Solexa Solexa+64, raw reads typically (-5, 40)</span>
| |
| <span style="color: blue" >I - Illumina 1.3+ Phred+64, raw reads typically (0, 40)</span>
| |
| <span style="color: orange">J - Illumina 1.5+ Phred+64, raw reads typically (3, 40)
| |
| with 0=unused, 1=unused, 2=Read Segment Quality Control Indicator (bold)
| |
| (Note: See discussion above).</span>
| |
| <span style="color: brown" >L - Illumina 1.8+ Phred+33, raw reads typically (0, 41)</span>
| |
| | |
| ===Color space===
| |
| For SOLiD data, the sequence is in color space, except the first position. The quality values are those of the Sanger format. Alignment tools differ in their preferred version of the quality values: some include a quality score (set to 0, i.e. '!') for the leading nucleotide, others do not. The sequence read archive includes this quality score.
| |
| | |
| ===Compression===
| |
| Quality values account for about half of the required disk space in the FASTQ format (before compression), and therefore the compression of the quality values can significantly reduce storage requirements and speed up analysis and transmission of sequencing data. Both lossless and lossy compression are recently being considered in the literature. For example, the algorithm QualComp <ref>Ochoa, Idoia, et al. "QualComp: a new lossy compressor for quality scores based on rate distortion theory." BMC bioinformatics 14.1 (2013): 187. http://www.biomedcentral.com/1471-2105/14/187/</ref> performs lossy compression with a rate (number of bits per quality value) specified by the user. Based on rate-distortion theory results, it allocates the number of bits so as to minimize the MSE (mean squared error) between the original (uncompressed) and the reconstructed (after compression) quality values. Other algorithms for compression of quality values include SCALCE <ref>Hach F, Numanagi ́c I, Alkan C, Sahinalp SC:SCALCE: boosting sequencecompression algorithms using locally consistent encoding.Bioinformatics2012,28(23):3051–3057.</ref> and Fastqz.<ref>fastqz.http://mattmahoney.net/dc/fastqz/</ref> Both are lossless compression algorithms that provide an optional controlled lossy transformation approach. For example, SCALCE reduces the alphabet size based on the observation that “neighboring” quality values are similar in general.
| |
| | |
| ==File extension==
| |
| There is no standard [[file extension]] for a FASTQ file, but .fq and .fastq, are commonly used.
| |
| | |
| ==Format converters==
| |
| *[[BioPython|Biopython]] version 1.51 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
| |
| *[[EMBOSS]] version 6.1.0 patch 1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
| |
| *[[BioPerl]] version 1.6.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
| |
| *[[BioRuby]] version 1.4.0 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
| |
| *[[BioJava]] version 1.7.1 onwards (interconverts Sanger, Solexa and Illumina 1.3+)
| |
| *[http://maq.sourceforge.net MAQ] can convert from Solexa to Sanger (use this [http://sourceforge.net/tracker/index.php?func=detail&aid=2824334&group_id=191815&atid=938893 patch] to support Illumina 1.3+ files).
| |
| *[http://hannonlab.cshl.edu/fastx_toolkit/ fastx_toolkit] The included fastq_quality_converter program can convert Illumina to Sanger
| |
| | |
| ===Command line conversions===
| |
| | |
| '''FASTQ to FASTA format:'''
| |
| | |
| <pre>zcat input_file.fastq.gz | awk 'NR%4==1{printf ">%s\n", substr($0,2)}NR%4==2{print}' > output_file.fa</pre>
| |
| | |
| '''Illumina FASTQ 1.8 to 1.3'''
| |
| | |
| <pre>sed -e '4~4y/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJ/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/' myfile.fastq # add -i to save the result to the same input file</pre>
| |
| | |
| '''Illumina FASTQ 1.3 to 1.8'''
| |
| | |
| <pre>sed -e '4~4y/@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\\]^_`abcdefghi/!"#$%&'\''()*+,-.\/0123456789:;<=>?@ABCDEFGHIJ/' myfile.fastq # add -i to save the result to the same input file</pre>
| |
| | |
| ==See also==
| |
| *[[FASTA format]]
| |
| *[[Phred quality score]]
| |
| *[[List of file formats#Biology|List of file formats for molecular biology]]
| |
| | |
| ==References==
| |
| {{reflist|2}}
| |
| | |
| ==External links==
| |
| *[http://maq.sourceforge.net/fastq.shtml MAQ] webpage discussing FASTQ variants
| |
| *[http://bitbucket.org/galaxy/galaxy-central/src/tip/tools/fastq/ Galaxy fastq tools]
| |
| *[http://hannonlab.cshl.edu/fastx_toolkit/ Fastx toolkit] collection of command line tools for Short-Reads FASTA/FASTQ files preprocessing
| |
| *[http://www.bioinformatics.bbsrc.ac.uk/projects/fastqc/ Fastqc] quality control tool for high throughput sequence data
| |
| *[http://prinseq.sourceforge.net/ PRINSEQ] can be used for QC and to filter, reformat, or trim sequence data (web-based and command line versions)
| |
| | |
| {{DEFAULTSORT:Fastq Format}}
| |
| [[Category:Bioinformatics]]
| |
| [[Category:Biological sequence format]]
| |
Many businessmen and sales agents struggle with generating leads. Some complicate the process while others spend their time in search of the secret formula or magic topic. Cutting corners and searching for short cuts will just waste your energy.
He accomplishes this by with instructions on how to build sales funnels in your marketing campaigns. Once in place, you can direct that traffic to the opportunity (MLM, affiliate product, etc.,). They also need to get built the simplest way. Jonathan shows you how to obtain the biggest impact for your determination.
We were talking on what you could start while using small end of product sales funnel - the expensive product rather than the big end, with the freebie along with $10 product, and then design whole sales funnel to push towards this big product, instead of creating bigger and larger products.
Are just small an entrepreneur or a startup guru? Do you sell local services or do you ship everywhere around the world? Do you depend on online lead generation or sales or want a website for branding purposes? Is that going as a major or critical website or just minisite among many other things? How long will it get in use a year, several years or as long as possible?
If you want a better response from your readers, something else you is capable of doing is offer them a bribe, something like that for completely. Just convince people that the giving them something useful free of charge, and they'll be delighted to accept. It is a great to be able to get more subscribers on your own email checklist. You can actually benefit as a result in two different suggestions.
If your internal dialogue begins to resemble a needle stuck on a record, and also find yourself repeating a detrimental scenario, distracting yourself for 8 minutes will offer you relief may possibly help you interrupt your negative self-talk according to author Dr. Susan Nolen-Hoeksema, Ph.D., Women who Think A great deal of. Exaggerating the situation until absolutely find humor in the absurdity of your thinking is yet way to combat negative ruminating and be accepted as more resilient, says Karen Reivich, Ph.D., coauthor of The Resilience Factor.
Another proven email marketing technique is personalizing emails by using people's first names. Nothing is more vital that a person than specific name. Carry out using your contact's name in subject of line and body of the email, realizing what's good get effortless reading and responding for one's emails. A person are want much less reading your emails also higher click through rate, make sure you accomplish that. Everyone wants to feel unique and in contrast to an anonymous "friend" or "marketer." Your goals should be to develop long lasting connections with folks on your email list, as this will give you the best results.
If you have just about any inquiries about exactly where in addition to the way to work with full rss feed; http://schooltechsupply.com/,, you are able to email us from our web site.